This peptide has antibacterial activity against several Gram-positive and Gram-negative bacteria. Bombyx mori cecropinB1(BmCecB1) is antimicrobial peptides from Bombyx mori and belongs to cecropin family. Antimicrobial peptides are important components of the innate immune systems in all living organism. To produce the BmCecB1 antimicrobial peptide, we constructed transgenic silkworm that expressed BmCecB1 gene under the control BmA3 promoter using piggyBac vector. The use of the 3xP3-driven EGFP cDNA as a marker allowed us to rapidly distinguish transgenic silkworm. Mixtures of the donor vector and helper vector were micro-injected into 600 eggs of bivoltin silkworms, Baegokjam. In total, 49 larvae (G0) were hatched and allowed to develop into moths. The resulting G1 generation consisted of 22 broods, and we selected 2 broods containing at least 1 EGFP-positive embryo. The rate of successful transgenesis for the G1 broods was 9%. We identified 9 EGFP-positive G1 moths and these were backcrossed with wild-type moths. With the aim of identifying a BmCecB1 as antimicrobial peptide, we investigated the Radical diffusion Assay (RDA) and then demonstrated that BmCecB1 possesses high antibacterial activities against Gram-negative bacteria.
Insects have powerful innate immunity against microorganisms. Their immune system comprises both humoral and cellular reactions. The humoral reactions involve soluble proteins in the hemolymph, such as phenoloxidase, antimicrobial proteins (AMPs), lysozymes, and lectins; whereas hemocytes mediate cellular reactions such as phagocytosis, encapsulation, and nodule formation (Tanaka
Recently, a germline transformation method using the
The
We constructed the transition vector pG-3xP3-EGFP-BmA3-bPDIsp-BmCecB1. The BmA3 promoter was generated by PCR amplification with specific primers (forward primer, 5’- GGCGCGCCGCGCGTTACCATATATGGTG -3 ’ and reverse primer 5’- GCTAGCCTTGAATTAGTCTGCAAGAAA -3’). The PCR product was cloned into the pGEM-T-easy vector (Promega, Madison, Wi, USA) and named pGEM-BmA3. BmA3 promoter was excised from pGEM-BmA3 with AscI and
>
Transgenesis and screening of silkworms
For egg preparation, male and female moths were allowed to mate for at least 4 h at 25℃. The mating moths were stored overnight at 4℃. The female moths were placed on a plastic sheet and left in dark boxes for 1 h. The laid eggs were immersed in HCl (specific gravity 1.0955, 25℃) for 30 min at 25℃, rinsed with distilled water, and finally dried. The transition vector pG-3xP3-EGFP-BmA3-bPDIsp-BmCecB1 and the helper vector pHA3PIG were dissolved in 5 mM KCl and 0.5 mM phosphate buffer (pH 7.0) at a concentration of 0.2 μg/μL and mixed at a ratio of 1:1. Approximately 5–10 nL of this mixture were injected using an IM300 microinjector (Narishige Scientific Instrument Lab., Japan) into preblastoderm embryos at 2–8 h after oviposition (Tamura et al. 2007). Injected embryos were allowed to develop at 25℃ in moist chambers. G1 embryo and larvae were screened under a fluorescence stereomicroscope equipped with a GFP filter (Leica, Wetzlar, Germany ).
Genomic DNA was purified using a QIAamp DNA Mini Kit (QIAGEN Gmbh, Germany) from G1 moths. Purified genomic DNA was digested with Sau3AI (NEB, Hitchin, Hertfordshire, UK) and circularized by overnight ligation at 16℃ with T4 DNA ligase (Promega, USA). PCR was performed on the ligated DNA using primer sequences between the restriction site and the end sequence of the transition vector. For the 5’ junction, the primer pair was 5’-ATCAGTGACACTTACCGCATTGACA-3’ and 5’-TG ACGAGCTTGTTGGTGAGGATTCT-3’. For the 3’ junction, the primer pair was 5’-TACGCATGATTATCTTTAACGTA-3’ and 5’-GGGGTCCGTCAAAACAAAACATC-3’ (Tamura
>
Analysis of antimicrobial activity
Transgenic silkworms were tested for antibacterial activity with an inhibition zone assay. In brief, 0.5 g of tissue from fifth-instar larvae of
>
Generation of transgenic silkworm
express the BmCecB1 gene under the control of
We isolated one of the G1 broods showing the highest level of fluorescence. To analyze the insertion sites in this transgenic silkworm, inverse-PCR experiments were performed using genomic DNA from the G1 moths. As shown in Table 2, we identified one genomic junction sequence. This sequence revealed the characteristic TTAA duplication at the PiggyBac junction with chromosomal DNA. We searched using KAIKOBLAST (http://sgp.dna.affrc.go.jp) and matched this sequence with contiguous sequences in the database. Thus, inverse PCR analysis of the G1 generations confirmed the stable insertion of BmCecB1 into the genome.
The antimicrobial activities of of BmCecB1 was examined against various poultry pathogens such as
Globally, antibiotics have been used in the animal industry for growth promotion and the prevention and treatment of disease for more than fifty years (Looft
Our results confirmed that for achieving best antibacterial peptide productivity of BmCecB1 in Silkworm. To produce the BmCecB1 antimicrobial peptide, we constructed transgenic silkworm and selected 2 broods containing at least 1 EGFP-positive embryo. With the aim of identifying a BmCecB1 as antimicrobial peptide, we investigated the radical diffusion assay (RDA) and showed antimicrobial activity against Gram-negative bacteria. These results suggest that BmCecB1 peptide may be useful as a feed additive in livestock diets.